<span>helicase<span>DNA helicase is the enzyme that unwinds the DNA double helix by breaking the hydrogen bonds down the center of the strand. It begins at a site called the origin of replication, and it creates a replication fork by separating the two sides of the parental DNA.<em /></span></span>
Answer:
Fourth trimester.
Explanation:
Fourth trimester is the fourth stage in which abortion can not be done because the baby is big enough in size and comes out from the womb. The abortion in this stage can put the life of the mother in danger so that's why abortion is not allowed. Newborn babies are learning to adjust itself to life outside the womb where it was warm so we can say that fourth trimester is the stage in which abortion is risky and dangerous.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
1/300,000 or <span>0.00000333333
</span>
Tiny droplets of water and ice crystals
