How is light energy processed in the light reaction of photosynthesis?

Biology

2 answers:

Tcecarenko [31]2 years ago

8 0

Correct Answer is - B.) Through an electron transport chain

Licemer1 [7]2 years ago

6 0

Light energy is processed in the light reaction of photosynthesis through an electron transport chain .

In photosynthesis, the light energy is first captured by the light harvesting complex of chloroplast of green leafs and used to split water by the process of photolysis. The process of photolysis causes release of oxygen and electron from water. This resulting electron is then absorbed by the photosystem II located in the chloroplast due to which photosystem II reaches higher energy level. Thenafter, the electron is passed from a series of complexes to photosystem I. Ultimately the electron from photosystem I reaches NAD+ and reduces it to NADH which is further used as energy source in the dark reaction of photosynthesis. This passage of electron from various complexes is known as electron transport chain or electron transport system.

You might be interested in

Three lots with parallel side boundaries extend from the avenue to the boulevard as shown answer

larisa86 [58]

Three lots with parallel side boundaries extend from the avenue to the boulevard as shown in the diagram attached.

Given;
x + y + z = 140 meters

According to the proportion theorem,

$\frac{x}{40} = \frac{y}{30}$

Solving for x, using cross multiplication:

$\frac{x}{1} = \frac{40y}{30}$

Similarly,

x/40 = z/35

solving for z by cross multiplication,

z = 35x/40
z = 7x/8

Now, the third proportions,
y/30 = z/35

Solving for y,

y = 30z/35
y = 6z/7

x + y + z = 140

4y/3 + 6z/7 + 7x/8 = 140

(224y + 144z + 147x)/168 = 140

224y + 144z + 147x = 23520

Substitutoing z = 7x/8,

224y + (144 × 7x/8) + 147x = 23520

224y + 126x + 147x = 23520

224y + 273x = 23520
Now,
Substitute y = 3x/4

(224×3x/4) + 273x = 23520

168x + 273x = 23520

441x = 23520

x = 53.33

Now,
We know that
y = 3x/4
so,
y = 40

And,
z = 7x/8
Z = 46.66

3 0

2 years ago

Hi,Cyclone occur over the oceans of equatorial region why give reason

taurus [48]

Answer:

Cyclones are actually water born storms in the equatorial regions.

Mainly, water near this equator get heated up as it receives direct sunlight, the hot air rises up and to fill this empty space cold air from poles rush to these equatorial regions. And hence the cyclones are mostly formed in Equatorial regions.

6 0

2 years ago

Read 2 more answers

all plants give out oxygen during day and carbon dioxide during 9 to you agree with this statement give reason

ankoles [38]

Answer:

Yes, I agree with the given statement.

Explanation:

Plants undergo the process of photosynthesis for the production of their food. In this process, they require the presence of sunlight, carbon dioxide, water, minerals, and chlorophyll. The process of photosynthesis is possible only during the day because sunlight is one of the major components. Carbon dioxide is taken in by the plant through the stomata from the environment. The oxygen is formed as a product of the process and is released in the environment. This process becomes impossible during the night because of the absence of sunlight. The entire process sums up to that the plants give out oxygen during the day and give out carbon dioxide during the night.

7 0

2 years ago

What would you expect to be different about a muscle cell in an animal? Why?

nekit [7.7K]

Have a lot of mitochondria so that more respiration providing muscles with more energy for muscle contraction

Hope it’s useful

3 0

1 year ago

5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’

stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0

2 years ago