The vascular cambium _____.

1 answer:

4 0

The vascular cambium produces secondary phloem and xylem tissue.
<span>Vascular cambium, a plant tissue located between the xylem and the phloem in the stem of a vascular plant. It is also the source of both secondary xylem growth and the secondary phloem growth. Vascular cambium is usually found on dicots and gymnosperms not on monocots which usually lack secondary growth. It does not transport water, dissolved food or minerals by plants. </span> <span>Vascular cambia are cylinders of unspecialized meristem cells which divide to make new cells which specialize to form secondary vascular tissues.</span>

You might be interested in

Mitochondria are like kidneys in that the filter out Waste. True or false?

RoseWind [281]

False , mitochondria create energy.

4 0

2 years ago

Which weather events can cause damage during a thunderstorm

Yakvenalex [24]

Explanation:

Tornado is damaging during a thunderstorm;)

6 0

3 years ago

Read 2 more answers

When performing a lab you have chemicals left over and unused. What should you do with the unused chemicals? A) Return the chemi

Mamont248 [21]

C) Is the correct answer I believe, unless you want to flush the chemicals down the sink and then have a reaction with them the next time you go swimming in a lake and find them there.

3 0

2 years ago

You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a

frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0

2 years ago

Food,water,and wastes are stored inside what

lbvjy [14]

Those things are stored inside your body. Hope this helps! ^-^

7 0

2 years ago

Read 2 more answers