Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Evaporation
Explanation:
Evaporation is one change that would cause more water to evaporate from a stream.
Evaporation is a phase change in which liquid is changed into its gaseous form.
- When a substance is heated from solid to liquid, it melts.
- After melting, additional heat causes a phase change that allows for the liquid to change to gases.
- In the water cycle, the sun provides heat energy that causes surface water in streams to be heated.
- This leads to evaporation of the surface water into the atmosphere where they can be condensed to form precipitation.
Learn more:
Phase change brainly.com/question/10972073
#learnwithBrainly
Definitely i would expect them to concern themselves with your problems when they are so beset with their own. Beset means having a lot of trouble with something, or having to deal with a lot of something causes problems. For example in a sentence; With the amount of traffic nowadays, even a trip across town is beset with dangers.
Answer:
answer is false
Explanation:
it does not decline the cell division rate, but, instead boost d division
Answer: not trying to steal points but whats the question
Explanation:
