<span>cartilaginous Is the word you can use to fill in the blank!</span>
Enzymes can be best described as catalysts in living systems. This is because enzymes accelerate chemical reactions without being used up in the process.
Answer:
deforestation is when an area of trees is cleared. reforestation is when a bunch of trees are planted and grown to revive what once was an area of trees.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
d. all of the above are true.
