What forms when one oceanic plate is forced beneath another plate is C. a subduction zone.
The name itself can explain it all - the prefix sub- in Latin means 'under,' and given that beneath and under mean the same, subduction zone is the answer you should pick. The other options do not show such a relationship which is why they are wrong.
Answer:
It is possible for large molecules to join a cell by a method called endocytosis, where a small piece of the cell membrane surrounds the particle and is brought into the cell. If the particle is solid, endocytosis is also dubbed phagocytosis. If fluid droplets are taken in, the process is called pinocytosis.
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
Blank 1: Inner membrane of the Mitochondria
Blank 2: matrix of the mitochondria
Blank 3: their own nucleus
Blank 4: DNA
Hope this helps.
Disruption in protein homeostasis leads to the appearance and accumulation of intermediate nonnative conformations that tend to form oligomeric and aggregated species, which over time cause cellular injury..